View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_109 (Length: 243)
Name: NF3173_high_109
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_109 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 90 - 227
Target Start/End: Original strand, 29422314 - 29422451
Alignment:
| Q |
90 |
cactattatggctgctacttatgaacctgaagatcctttgtttcatccttcaactaagattacaacattgttcacttctaagtccaatgctacttttaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422314 |
cactattatggctgctacttatgaacctgaagatcctttgtttcatccttcaactaagattacaacattgttcacttctaagtccaatgctacttttaag |
29422413 |
T |
 |
| Q |
190 |
tctgataacagtgttgtgaaaactggtgaggattttat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422414 |
tctgataacagtgttgtgaaaactggtgaggattttat |
29422451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 29422235 - 29422274
Alignment:
| Q |
11 |
cagagaatttaggtcagaatactatggccatgattgggaa |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29422235 |
cagagaatttaggtcagaatactatggccatgattgggaa |
29422274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University