View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_110 (Length: 241)
Name: NF3173_high_110
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_110 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 54097620 - 54097841
Alignment:
| Q |
2 |
tgaaatatgtttgacatgttttctaccgtgtgaaaacagttatgacttatgagttatgatgaccgcgtgactttgacatttttattatacaatgttttga |
101 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||| |
|
|
| T |
54097620 |
tgaaatatgtttgacctgttttctaccgtgtgaaaacagttatgacttatgagttatgatgaccgcgtgactttgacatttttattagacgaagttttga |
54097719 |
T |
 |
| Q |
102 |
ccgttattctggaatttgtatggttttatagggaggattttaggaagcagttcaagaaggataaccctgacaacaaagctgtgtccgctgtaagtatcca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54097720 |
ccgttattctggaatttgtatggttttatagggaggattttaggaagcagttcaagaaggataaccctgacaacaaagctgtgtccgctgtaagtatcca |
54097819 |
T |
 |
| Q |
202 |
ttgttgttttgttggcctgtat |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54097820 |
ttgttgttttgttggcctgtat |
54097841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University