View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_128 (Length: 229)
Name: NF3173_high_128
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_128 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 30668229 - 30668003
Alignment:
| Q |
1 |
acagaaactcagaaagagacgaattttacaataaccagccaaatatatctaaccatgcaatgctattttcctaattaacttgcagcattcttaggccttt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30668229 |
acagaaactcagaaaga--cgaattttacaataaccagccaaatatatctaaccatgcaatgctattttcctaattaacttgcagcattcttaggccttt |
30668132 |
T |
 |
| Q |
101 |
tgtaacgatgacaataacacattaacacgttatttgatcatttgaaatcagttagtttggatcccccaaaatttgccgatgccaggccaagagagcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
30668131 |
tgtaacgatgacaataacacattaacacgtcatttgatcatttgaaatcagttagtttggatcccccaaaattagccgatgccaagccaagagagcattg |
30668032 |
T |
 |
| Q |
201 |
ttcaactgtgacaactcttgagctggctt |
229 |
Q |
| |
|
|||||| ||||||||||| ||||||||| |
|
|
| T |
30668031 |
ttcaaccatgacaactcttaagctggctt |
30668003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University