View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_136 (Length: 208)
Name: NF3173_high_136
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_136 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 51729348 - 51729154
Alignment:
| Q |
1 |
tcatatcatatagtaaggaatacagcattgaacnnnnnnntattctgttatggctgctaaatgtatagctaattgtttcttgatgtgcaatctaaaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729348 |
tcatatcatatagtaaggaatacaacattgaacaaataaatattctgttataggtgctaaatgtatagctaattgtttcttgatgtgcaatctaaaatag |
51729249 |
T |
 |
| Q |
101 |
aggcttggcatttcgaagttcattgagtcctaccttctgtggaaatttccattggagaagtatgatttaaaaccagaacacccttttgaggagga |
195 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51729248 |
aggcttggcatttcaaagttcattgagtcctaccttctgtggaaatttccattggagaagtatgatttaaaaccagaacacccttttgcggagga |
51729154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 192
Target Start/End: Original strand, 19056564 - 19056657
Alignment:
| Q |
99 |
agaggcttggcatttcgaagttcattgagtcctaccttctgtggaaatttccattggagaagtatgatttaaaaccagaacacccttttgagga |
192 |
Q |
| |
|
||||||||| ||||| |||||||| ||||||||| | || |||||| ||||||| |||||||||| || ||||||||||||||||||||||| |
|
|
| T |
19056564 |
agaggcttgtgatttcaaagttcatagagtcctacttgctttggaaacttccattagagaagtatgggttgaaaccagaacacccttttgagga |
19056657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 192
Target Start/End: Complemental strand, 19188635 - 19188542
Alignment:
| Q |
99 |
agaggcttggcatttcgaagttcattgagtcctaccttctgtggaaatttccattggagaagtatgatttaaaaccagaacacccttttgagga |
192 |
Q |
| |
|
||||||||| ||||| |||||||| ||||||||| | || |||||| ||||||| |||||||||| || ||||||||||||||||||||||| |
|
|
| T |
19188635 |
agaggcttgtgatttcaaagttcatagagtcctacttgctatggaaacttccattagagaagtatgggttgaaaccagaacacccttttgagga |
19188542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University