View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_40 (Length: 383)
Name: NF3173_high_40
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 160 - 360
Target Start/End: Original strand, 49766980 - 49767180
Alignment:
| Q |
160 |
cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctgtatggatgatcaatgcattgcatgccatcaatggaatcatc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766980 |
cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctatatggatgatcaatgcattgcatgccatcaatggaatcatc |
49767079 |
T |
 |
| Q |
260 |
ttcaacaccaatgttaactcttnnnnnnnnnnnnnnnnntcctttcataggttccatgtggaggatgtgaatcatccaaatctaaaataatagtatcttg |
359 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767080 |
ttcaacaccaatgttaactcttccaccaccaccacctcctcctttcataggttccatgtggaggatgtgaatcatccaaatctaaaataatagtatcttg |
49767179 |
T |
 |
| Q |
360 |
t |
360 |
Q |
| |
|
| |
|
|
| T |
49767180 |
t |
49767180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 49766818 - 49766881
Alignment:
| Q |
1 |
ttacagcagttgtagctgatacagtgttgatg---gaagaagaagaaggacaatgacgagtagt |
61 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49766818 |
ttacagcagttgttgctgatacagtgttgatggaagaagaagaagaaggacaatgacgagtagt |
49766881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14137753 - 14137707
Alignment:
| Q |
162 |
agtttaccaagtttttcttgaagacaaaaagcacagatcccaccagg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14137753 |
agtttaccaagtttttcttgaagacaaaaagcacatataccaccagg |
14137707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University