View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_60 (Length: 318)
Name: NF3173_high_60
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 35899809 - 35899509
Alignment:
| Q |
1 |
acgttctatacgacttgagggaaacccatttaacgaggatcgttttatcaacaccaaggaccttgttaagtcttcagacccgaggggtttgttaggtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899809 |
acgttctatacgacttgagggaaacccatttaacgaggatcgttttatcaacaccaaggaccttgttaagtcttcagacccgaggggtttgttaggtaat |
35899710 |
T |
|
| Q |
101 |
ctttaagatttacttgtgcttatatttgatttgacgatttatttactgatttcgttgttttctcgtttgaagttaacatggctggactacaagaaaagct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899709 |
ctttaagatttacttgtgcttatatttgatttgacgatttatttactgatttcgttgttttctcgtttgaagttaacatggctggactacaagaaaagct |
35899610 |
T |
|
| Q |
201 |
gaagaaactaagtatgaagcctggagtttggtcgactgggtcaaagaggaaggaccctcgcagtctcaacgcgctcttggctagggctacaggctcatct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35899609 |
gaagaaactaagtatgaagcctggagtttggtcgactgggtcaaagaggaaggaccctcgcggtctcaacgcgctcttggctagggctacaggctcatct |
35899510 |
T |
|
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
35899509 |
t |
35899509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University