View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_63 (Length: 315)
Name: NF3173_high_63
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 8818018 - 8818319
Alignment:
| Q |
1 |
catggcagtttagttccttctgcagttttgatcagatatggatttggtgggacccacaatgaccagattggtcggggattacatactgggtcctcgtatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8818018 |
catggcagtttagttccttctgcagttttgatcagttatggatttggtgggacccacaatgaccagattggtcggggattacatactgggtcctcgtatc |
8818117 |
T |
|
| Q |
101 |
ggttcaggttcatttgcagtggtgtggcgttcacgtcatcgaaattcaggtttggaggtagcaattaaggaaattgataagacccaattgagttctaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8818118 |
ggttcaggttcatttgcagtggtgtggcgttcacgtcatcgaaattcaggtttggaggtagcaattaaggaaattgataagacccaattgagttctaaag |
8818217 |
T |
|
| Q |
201 |
ttagagataatctcatcaaagagatttctattcttagtactattcatcatcctaatatcattcaactctttgaagctattcaggtttctttctttgtttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8818218 |
ttagagataatctcatcaaagagatttctattcttagtactattcatcatcctaatatcattcaactctttgaagctattcaggtttctttctttgtttt |
8818317 |
T |
|
| Q |
301 |
tg |
302 |
Q |
| |
|
|| |
|
|
| T |
8818318 |
tg |
8818319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University