View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_92 (Length: 251)
Name: NF3173_high_92
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 6848855 - 6848780
Alignment:
| Q |
13 |
aatatgtcctgatcgatttgaagttgaatttgtaataagatgtgttcttattgttattgttattgcctttacctag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6848855 |
aatatgtcctgatcgatttgaagttgaatttgtaataagatgtgttcttattgttattgttattgcctttacctag |
6848780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 148 - 251
Target Start/End: Complemental strand, 6848720 - 6848618
Alignment:
| Q |
148 |
tatgttctcactccatctgtttcaaaatgaacgtcactttatcaacnnnnnnnnnngttttagaatgaaagtgatttgcgttctttaatgtaagattaac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6848720 |
tatgttctcactccatctgtttcaaaatgaacgtcactttatcaac-agaaaaaaagtttcagaatgaaagtgatttgcgttctttaatgtaagattaat |
6848622 |
T |
|
| Q |
248 |
tggt |
251 |
Q |
| |
|
|||| |
|
|
| T |
6848621 |
tggt |
6848618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University