View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_94 (Length: 250)
Name: NF3173_high_94
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_94 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 30667739 - 30667970
Alignment:
| Q |
19 |
acgttatgactccagtctttgatggagaaatagacacttcttgatgagtgttttccactgagaaatacttcaaaaggtgggacacatcaaaggaggagaa |
118 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30667739 |
acgttatgactcaagtctttgacggagaaatagacacttattgatgagtgttttccactgagaaatacttcaaaaggtgggacacatcaaaagaggagaa |
30667838 |
T |
|
| Q |
119 |
aattttggtggctgggattgcaatgagagaccgggctctcacatagtgactctggtggtatccatgccatccattagtgagttgtgacgcttttagcact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30667839 |
gattttggtggctgggattgcaatgagaggccgggctctcacatagtgactctgatggtatccatgccatccattagtgagttgtgacgcttttagcact |
30667938 |
T |
|
| Q |
219 |
gtattgatgtggcagatttaaggccgaatatc |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
30667939 |
gtattgatgtggcagatttaaggctgaatatc |
30667970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University