View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_high_98 (Length: 250)
Name: NF3173_high_98
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_high_98 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 32015244 - 32015470
Alignment:
| Q |
1 |
tatgctttg-gttggcaacccttcttcaccatccattgtcaaagacaaaaacttttgtcaaataattaatcagactcacacgaaaaagtcccaattttgt |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32015244 |
tatgctttgagttggcaacccttcttcaccatccattgtcaaagacaaa--cttttgtcaaataattaatcagactcacacgaaaaagtcccaattttgt |
32015341 |
T |
 |
| Q |
100 |
tcatagaatcatacttgaaatttttgttttggggcatcttgttcaaccttgtac-tctttaagtcgnnnnnnnattatgaacaacttgttgcttgatgtt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| ||| | ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32015342 |
tcatagaatcatacttgaaatttttgttttggggcatcttgttcaccctcttacttttttaagtcgtttttttattatgaacaacttgttgcttgatgtt |
32015441 |
T |
 |
| Q |
199 |
ttaagttttattgtcttgattttgaacta |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32015442 |
ttaagttttattgtcttgattttgaacta |
32015470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University