View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_102 (Length: 250)
Name: NF3173_low_102
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_102 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 45676065 - 45675842
Alignment:
| Q |
13 |
cagagcaagaagagaattccataattgaacttcatgcactcctaggcaacaggtaccaataattgtaataattaaggaactgataagtgttgcatttaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45676065 |
cagagcaagaagagaattccataattgaacttcatgcactcctaggcaacaggtaccaataattgtaataattaaggaattgataagtgttgcatttaga |
45675966 |
T |
 |
| Q |
113 |
tttggcttttaattaagtcatcaagattattttgttacatgcnnnnnnnnnnnnnnctttctacgaatcgaagcgacaatgactaatatactttggtgcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45675965 |
tttggcttttaattaagtcatcaagattattt--ttattt------------ttttctttctacgaatcgaagcgacaatgactaatatactttggtgcc |
45675880 |
T |
 |
| Q |
213 |
ttttgaattatcaggtggtcgcagattgcagctcagtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45675879 |
ttttgaattatcaggtggtcgcagattgcagctcagtt |
45675842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University