View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_105 (Length: 249)
Name: NF3173_low_105
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_105 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 85 - 237
Target Start/End: Original strand, 495035 - 495188
Alignment:
| Q |
85 |
tttgatgcactatgatatattagttattagtaatt-actattatatcaatgctttaaaaatataatttcccccttgaacagagaaaatattgtgttttcg |
183 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||| || |
|
|
| T |
495035 |
tttgatgcactatgataaattagttattagtaatttactattgtatcaatgctttaaaaatataatttccccctagaacagagaaaataatgtgtaatca |
495134 |
T |
 |
| Q |
184 |
gtgtagtctgcctgtcaaaaggcctagattaaagagattgatttcttttccctt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
495135 |
gtgtagtctgcctgtcaaaaggcctagattaaagagattgatttcttttccctt |
495188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University