View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3173_low_105 (Length: 249)

Name: NF3173_low_105
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3173_low_105
NF3173_low_105
[»] chr5 (1 HSPs)
chr5 (85-237)||(495035-495188)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 85 - 237
Target Start/End: Original strand, 495035 - 495188
Alignment:
85 tttgatgcactatgatatattagttattagtaatt-actattatatcaatgctttaaaaatataatttcccccttgaacagagaaaatattgtgttttcg 183  Q
    ||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||  ||     
495035 tttgatgcactatgataaattagttattagtaatttactattgtatcaatgctttaaaaatataatttccccctagaacagagaaaataatgtgtaatca 495134  T
184 gtgtagtctgcctgtcaaaaggcctagattaaagagattgatttcttttccctt 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
495135 gtgtagtctgcctgtcaaaaggcctagattaaagagattgatttcttttccctt 495188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University