View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3173_low_107 (Length: 248)

Name: NF3173_low_107
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3173_low_107
NF3173_low_107
[»] chr6 (1 HSPs)
chr6 (1-217)||(32992245-32992451)


Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 32992451 - 32992245
Alignment:
1 tatttgtctcttactattatcgatgaaatattaattaannnnnnnactaatatattattatttattatacttcaatttttctaactcgttcgtctcataa 100  Q
    ||||||||||||||||||||||||||||||||||||||            | || |||||||||||||||||||||||||||||||||||||||||||||    
32992451 tatttgtctcttactattatcgatgaaatattaattaat-----------tttactattatttattatacttcaatttttctaactcgttcgtctcataa 32992363  T
101 taagtgacatatttgagatgtttataatgaga-cgggagagtaatagataaaaagaagtaaaaagaaaatcacttgaaccaaccgtggataccgattcaa 199  Q
    |||||||||||||||||||| |||||||||||  |||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||| ||||||||    
32992362 taagtgacatatttgagatgcttataatgagatggggagagtaatagataaaaagaagtacaaagaaaatcgcttgagccaaccgtggatatcgattcaa 32992263  T
200 accaattcaatctggttc 217  Q
    ||||||||||||||||||    
32992262 accaattcaatctggttc 32992245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University