View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_107 (Length: 248)
Name: NF3173_low_107
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_107 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 32992451 - 32992245
Alignment:
| Q |
1 |
tatttgtctcttactattatcgatgaaatattaattaannnnnnnactaatatattattatttattatacttcaatttttctaactcgttcgtctcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32992451 |
tatttgtctcttactattatcgatgaaatattaattaat-----------tttactattatttattatacttcaatttttctaactcgttcgtctcataa |
32992363 |
T |
 |
| Q |
101 |
taagtgacatatttgagatgtttataatgaga-cgggagagtaatagataaaaagaagtaaaaagaaaatcacttgaaccaaccgtggataccgattcaa |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
32992362 |
taagtgacatatttgagatgcttataatgagatggggagagtaatagataaaaagaagtacaaagaaaatcgcttgagccaaccgtggatatcgattcaa |
32992263 |
T |
 |
| Q |
200 |
accaattcaatctggttc |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32992262 |
accaattcaatctggttc |
32992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University