View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_109 (Length: 246)
Name: NF3173_low_109
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_109 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 174
Target Start/End: Complemental strand, 42398264 - 42398109
Alignment:
| Q |
19 |
aggacaaaatacatagaccacttacacctaaaatccatgtgagtctatttctcttggattcaagctgattataatgctttggtgatccattgtaatcctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42398264 |
aggacaaaatacatagaccacttacacctaaaatccatgtgagtctatttctcttggattcaagctgattataatgctttggtgatccattgtaatcctt |
42398165 |
T |
|
| Q |
119 |
gggcatttttaagctctgatcacaaatttacaaatacacaaattcacattagatta |
174 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42398164 |
gggcattttttagctctgatcacaaattttcaaatacacaaattcacattagatta |
42398109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University