View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_112 (Length: 244)
Name: NF3173_low_112
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_112 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 23 - 227
Target Start/End: Original strand, 7294463 - 7294667
Alignment:
| Q |
23 |
tgccaactattagtatcaagatgatgatgaggaatcctagacctgatgagtctgatgcatcctgtttgtgttgtgcataaatttctatgtgctctctgaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7294463 |
tgccaactattagtatcaagatgatgatgaggaatcctagacctgatgagtctgatgcatcctgtttgtgttgtgcataaatttctatgtgctctctgaa |
7294562 |
T |
|
| Q |
123 |
attctacttacataagcttctagctgttttggttttcataaactagctgcaataagttcggttgataagttagttcacttgttaaaagaatttgatttgc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7294563 |
attctacttacataagcttctagctgttttggttttcataaactagctgcaataagttcggttgataagttagttcacttgttaaaagaatttgatttgc |
7294662 |
T |
|
| Q |
223 |
ctatg |
227 |
Q |
| |
|
||||| |
|
|
| T |
7294663 |
ctatg |
7294667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 134 - 178
Target Start/End: Original strand, 7290820 - 7290864
Alignment:
| Q |
134 |
ataagcttctagctgttttggttttcataaactagctgcaataag |
178 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
7290820 |
ataagcttctagccgttttagttttcataaactagctgcaataag |
7290864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 57
Target Start/End: Original strand, 7290720 - 7290754
Alignment:
| Q |
23 |
tgccaactattagtatcaagatgatgatgaggaat |
57 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
7290720 |
tgccaactattagtataaagatgatgatgaggaat |
7290754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University