View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_117 (Length: 241)
Name: NF3173_low_117
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_117 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 31573270 - 31573031
Alignment:
| Q |
1 |
gtattaaagtgccatgatttttgcattactaataggaaaataatttttggacaccga-tttctcacnnnnnnnnnatatagataggaaataggttttggt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
31573270 |
gtattaaagtgccatgatttttgcattactaatgggaaaataaattttggacaccgaatttctcactttttttttatatagataggaaataggttttggt |
31573171 |
T |
 |
| Q |
100 |
ggtannnnnnngtggtacagtagaaaatagccactatatccatacgagtagtactgctagcataaccctgactaggtcatgctgtgctagcctcactcct |
199 |
Q |
| |
|
|||| ||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573170 |
ggtatttttttgtggtacagtaaaaaatagccgctatatccatacaagtagtactgctagcataaccctgactaggtcatgctgtgctagcctcactcct |
31573071 |
T |
 |
| Q |
200 |
tcctatttggagaccaatatatcatcaaagttacctaccttc |
241 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
31573070 |
tcctatttggagacca--atatcatctaagttacctaccttc |
31573031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 38348544 - 38348589
Alignment:
| Q |
162 |
taaccctgactaggtcatgctgtgctagcctcactccttcctattt |
207 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
38348544 |
taaccttgactaggtcatgctgtgacagcctcactctttcctattt |
38348589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University