View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_121 (Length: 239)
Name: NF3173_low_121
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_121 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 52591460 - 52591660
Alignment:
| Q |
19 |
tctattatctttgtctttaaagtagtatgtaaatcagattcattgttattttggtactcataaatttcatggaaaaagttatactattttgttgcggatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52591460 |
tctattatctttgtctttaaagtagtatgtaaatgagattcattgttattttggtactcataaatttcatggaaaaagttaa------------------ |
52591541 |
T |
 |
| Q |
119 |
atcaaaactttagataacgcaaacactaatttgtaaagaagaatgatttgttgagtttattttccattctgacttctcttagtttagttttttgacaaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52591542 |
--caaaactttagataacgcaaacactaatttgtaaagaagaatgctttgttgagtttattttccattctgacttctcttagtttagttttttgacaaca |
52591639 |
T |
 |
| Q |
219 |
tatatttgaataaagacccat |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52591640 |
tatatttgaataaagacccat |
52591660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University