View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_134 (Length: 229)
Name: NF3173_low_134
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_134 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 8 - 229
Target Start/End: Original strand, 33011019 - 33011254
Alignment:
| Q |
8 |
aaatttgacagcgttcgtgtcagtgacctttttgaaatattcaaattttagggacctatttgagagcaaccttaaaagtttgga------------gttt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33011019 |
aaatttgacagcgttcgtgtcagtgacctttttgaaatattcaaattttagggacctatttgagagcaaccttaaaagtttggaacgaaattggtggttt |
33011118 |
T |
|
| Q |
96 |
actgaaaa--aacatagttcaaggatgaaagagataaacctgcaaagacatttcgaataatttcctgctgcttttccacaggctgatcaaccacaacaca |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33011119 |
actgaaaaaaaacatagttcaaggatgaaagagataaacctgcaaagacatttcgaataatttcctgctgcttttccacaggctgatcaaccacaacaca |
33011218 |
T |
|
| Q |
194 |
aaaacaatgttataaaattgcattcacatataaaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33011219 |
aaaacaatgttataaaattgcattcacatataaaaa |
33011254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University