View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_135 (Length: 229)
Name: NF3173_low_135
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_135 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 212
Target Start/End: Complemental strand, 43546206 - 43546003
Alignment:
| Q |
10 |
gagcacagaggagtgtgtatctgttgatacgaattgaggtattttcttctttgccattggagtccatttttgcgtcactaaggagattgaaactgtcgaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43546206 |
gagcacagaggagtgtgtatctgttgatacgaattgaggtattttcttctttgccattggagtccatttttccgtcactaaggagattgaaactgtcgaa |
43546107 |
T |
|
| Q |
110 |
tgaaactcaatagtgaatcacataaataaataaaactcatttaatgaaattcatgaacattaataagttagataccaaagaagat-aagtggtcgaaacc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43546106 |
tgaaactcaatagtgaatcatataaataaataaaactcctttaatgaaattcatgaacattaataagttagataccaaagaagataaagtggtcgaaacc |
43546007 |
T |
|
| Q |
209 |
tcct |
212 |
Q |
| |
|
|||| |
|
|
| T |
43546006 |
tcct |
43546003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University