View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_35 (Length: 411)
Name: NF3173_low_35
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 9e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 214 - 395
Target Start/End: Complemental strand, 48017093 - 48016912
Alignment:
| Q |
214 |
tgtaaataacttttggtaaattattcgtaagtaattatgtaattgtttattgagtcttgacgtctattctaaccgtgatgtcaaagatccgattcatact |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48017093 |
tgtaaataacttttggtaaattattcgtaagtaattatgtaattgtttattgagtcttcacgtctattctaaccgtgatgtcaaagatctgattcatact |
48016994 |
T |
|
| Q |
314 |
catctaaactatttattcatcgttnnnnnnnncattatacaactttgttttctatccaatcctgacgtgagatgagctaact |
395 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48016993 |
catctaaactatttattcatcgttaaaaaaaatattatacaactttgttttctatccaatcctgacgtgagatgagctaact |
48016912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 48017244 - 48017093
Alignment:
| Q |
15 |
tactcaaacaaacaattaagactttttaacctcccacaatatttcatggcgttgtctttcccagcacacttggtaccattcttgcttctcattatgtcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48017244 |
tactcaaacaaacaattaagactttttaacctcccacaatatttcatggcgttgtctttcccagcacacttggtaccattcttgcttctcattatgtcac |
48017145 |
T |
|
| Q |
115 |
nnnnnnnaatatctacttattaaattattttagtccttgcaattgaaatgat |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48017144 |
tttttttaatatctacttattaaattattttagtccttgcaattgaaatgat |
48017093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University