View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_57 (Length: 342)
Name: NF3173_low_57
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_57 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 173 - 333
Target Start/End: Original strand, 25863245 - 25863405
Alignment:
| Q |
173 |
attataggtgtcgtgtcagtgttagacactaatgcgtgtcagacaccgggacatctctactcagagaagtgttcgtgcttcattgcttatatgtaatgtg |
272 |
Q |
| |
|
|||||| ||||||||||||||| | ||| ||||||||| |||||||| ||||| || | ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
25863245 |
attataagtgtcgtgtcagtgtcgggcaccgatgcgtgtctgacaccggaacatccttatttagagaagagtctgtgcttcattgcttatatgtaatgtg |
25863344 |
T |
|
| Q |
273 |
atgtatgcaccttgcagttaggaagtcaataacttgaacagtttgtttgatactttcatct |
333 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25863345 |
atgtatgcaccttgcagttaagaagtcaatgacttgaacagtttgtttgatactttcatct |
25863405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 29 - 74
Target Start/End: Original strand, 25863071 - 25863116
Alignment:
| Q |
29 |
aatgattatatatttcatatacaaataacatggaataattattact |
74 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25863071 |
aatgattatatatttaatatacaaataacatggaataattattact |
25863116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 73 - 145
Target Start/End: Complemental strand, 225383 - 225311
Alignment:
| Q |
73 |
ctatgaaacatggacacaaacatagataccggacacgacatagacattgatacgctgacacggataataattt |
145 |
Q |
| |
|
|||||||||| ||||||| ||| || ||||||||||||| |||| ||| |||| ||||| ||||||||||| |
|
|
| T |
225383 |
ctatgaaacacggacacagacacggacaccggacacgacacggacactgacacgccgacacagataataattt |
225311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 97 - 133
Target Start/End: Complemental strand, 17327746 - 17327710
Alignment:
| Q |
97 |
gataccggacacgacatagacattgatacgctgacac |
133 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
17327746 |
gataccggacacgacatagacagtgatacgccgacac |
17327710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 73 - 145
Target Start/End: Complemental strand, 24205156 - 24205084
Alignment:
| Q |
73 |
ctatgaaacatggacacaaacatagataccggacacgacatagacattgatacgctgacacggataataattt |
145 |
Q |
| |
|
||||||| || ||||||| ||| || ||||||||||||| |||| ||| |||| ||||||||||||||||| |
|
|
| T |
24205156 |
ctatgaagcacggacacagacacggacaccggacacgacacggacactgacacgccgacacggataataattt |
24205084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 255
Target Start/End: Original strand, 17778622 - 17778670
Alignment:
| Q |
207 |
cgtgtcagacaccgggacatctctactcagagaagtgttcgtgcttcat |
255 |
Q |
| |
|
|||||| ||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
17778622 |
cgtgtccgacaccgggacatgcctaatccgagaagtgttcgtgcttcat |
17778670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University