View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_78 (Length: 296)
Name: NF3173_low_78
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 54161878 - 54162126
Alignment:
| Q |
1 |
ttccggcagcgaaagtagctattagactggacttgccagttccattgtctccagcgacaacaatgcgaattccagtaagagcgtgtggggaaactgttgc |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
54161878 |
ttccggcagcgaaagtagcgattagactggacttgccagttccatcgtctccagcgacaacaatgcgaattccagtaagaacgtgtggggaaactgtt-c |
54161976 |
T |
 |
| Q |
101 |
catcgatacagcaatcgcaagcagaacaaaaatttaaaatccaagtttgtgctattaagagaacgagtaaataaattataacctgaaccctaaccaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54161977 |
catcgatacagcaatcgcaagcagaacaaaaatttaaaatccaagtttgt--ttgtgctagaacgagtaaatatattataacctgaaccctaaccaagtg |
54162074 |
T |
 |
| Q |
201 |
tgtgctaaatagtttcggtttctttttcaataagtaaat--aacttttgttt |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
54162075 |
tgtgctaaatagtttctgtttctttttcaataagtaaatagaacttttgttt |
54162126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University