View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_81 (Length: 285)
Name: NF3173_low_81
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_81 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 19637576 - 19637312
Alignment:
| Q |
1 |
gttcctgttttccatacccattcattacatgaaagtagtatcaaacatggcgtgcatgtgaatgtgcatgtgaatgggactcttaactggttgggcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19637576 |
gttcctgttttccatacccattcattacatgaaagtagtatcaaacatggcgtgcatgtgaatg------------ggactcttaactggttgggcattc |
19637489 |
T |
|
| Q |
101 |
aaagtgagttccataatgaacatcaaattgattggaaacatattagtaatgacaaatttgtgatcatttcgcttgatttgagtacagaggcatactgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19637488 |
aaagtgagttccataatgaacatcaaattgattggaaacatattagtaatgacaaatttgtgatcatttcgcttgatttgagtacagaggcatactgtca |
19637389 |
T |
|
| Q |
201 |
attgctgccccctcgaggttttgataaagtttcatgtgatcaaccaactcttgttgtgttgctggactccctttgct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19637388 |
attgctgccccctcgaggttttgataaagtttcatgtgttcaaccaactcttgttgtgttgctggactccctttgct |
19637312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 227
Target Start/End: Complemental strand, 19597876 - 19597799
Alignment:
| Q |
150 |
tgacaaatttgtgatcatttcgcttgatttgagtacagaggcatactgtcaattgctgccccctcgaggttttgataa |
227 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||| ||| ||| ||||| ||| ||| |||||||||| ||||||||||| |
|
|
| T |
19597876 |
tgaccaatttgtgatcatcttgcttgatttgattacggagacataccatcagttgttgccccctcggggttttgataa |
19597799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University