View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_85 (Length: 273)
Name: NF3173_low_85
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 34677053 - 34676802
Alignment:
| Q |
17 |
aagcttgaaactacttactatagtagctgcttttttgcattaataattggatccagtgaggacaaacgacactgtgtggctcactatttagcacattttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34677053 |
aagcttgaaactacttactatagtagctgcttttttgcattaataattggatccagtgaggacaa-cgacactgtgtggctcactatttagcacattttt |
34676955 |
T |
 |
| Q |
117 |
tattgaatgaaaataaactatagctatagggagaattaattcaattcatgat--------cttactcactcaccttacctttttcttagtactacatgat |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34676954 |
tattgaatgaaaataaaatatagctatagggagaattaattcaattcatgatctcactcactcactcactcaccttacctttttcttagtactacatgat |
34676855 |
T |
 |
| Q |
209 |
gaaaacaacaattcaaaacaagtttgggttgcagcagatagagacacaggttc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34676854 |
gaaaacaacaattcaaaacaagtttgggttgcagcagatagagacacaagttc |
34676802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University