View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_86 (Length: 268)
Name: NF3173_low_86
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 6848636 - 6848384
Alignment:
| Q |
1 |
taatgtaagattaactggtctgtaagattattgttgtggcttcgataaggatacattaatagtgaataaatttagtttggtaaaagtatattgtcttctt |
100 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6848636 |
taatgtaagattaattggtcggtaagattattgttgtggcttcgttaaggatacattaatattaaataaatttagtttggtaaaagtatattgtcttctg |
6848537 |
T |
 |
| Q |
101 |
acaccatcattgcatttctcaattgatgtaggaaaaaccttaaacaaaactttggcaagaacaagttgatcttctaatatagctgtcctttcactactag |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6848536 |
acaccatcattgcatttcttaattgatgtaggaaaaaccttaaacaaaactttggcaagaacaagttgatcttctaatataagtgtcctttcactactag |
6848437 |
T |
 |
| Q |
201 |
aaaaattgtcgttt--agaggccgatttagacactgaaataaattggcatagt |
251 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6848436 |
aaaatttgtcgtttagagaggccgatttagacactgaaataaattggcatagt |
6848384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 6848966 - 6848929
Alignment:
| Q |
7 |
aagattaactggtctgtaagattattgttgtggcttcg |
44 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6848966 |
aagattaactggtcgataagattattgttgtggcttcg |
6848929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University