View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_89 (Length: 266)
Name: NF3173_low_89
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_89 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 137 - 266
Target Start/End: Complemental strand, 22573753 - 22573623
Alignment:
| Q |
137 |
tgataacttttgttgggtactatttttagtagttctatatgtaaaaggtcc-atacatcattcaattttattttttcatctagtaggattaattgatatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22573753 |
tgataacttttgttgggtactatttttagtagttctatatgtaaaaggtcccatacaccattcaattttattttttcatctagtaggattaattgatatt |
22573654 |
T |
|
| Q |
236 |
caattcaacggtttataagcagtcatctttc |
266 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
22573653 |
caattcaacggtttataagcagtcagctttc |
22573623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 93 - 147
Target Start/End: Complemental strand, 22573991 - 22573937
Alignment:
| Q |
93 |
tataatacttacatatcatacccaccaatcacttgtagtagacctgataactttt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22573991 |
tataatacttacatatcatacccaccaatcacttgtagtagacctgataactttt |
22573937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 64
Target Start/End: Complemental strand, 22574038 - 22573988
Alignment:
| Q |
14 |
atgaatgaagacgatatatcaactagtttgtacatatgcaaaggtaatata |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22574038 |
atgaatgaagacgatatatcaactagtttgtacatatgcaaaggtaatata |
22573988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University