View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_93 (Length: 257)
Name: NF3173_low_93
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_93 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 87
Target Start/End: Original strand, 16486504 - 16486555
Alignment:
| Q |
36 |
gattaagggttttattcgagttagtgtatgaaaaatgttttttgagaataga |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16486504 |
gattaagggttttattcgatttagtgtatgaaaaatgttttttgagaataga |
16486555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 16486452 - 16486487
Alignment:
| Q |
1 |
actactaacatggtgcaacatattgtgatatattag |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16486452 |
actactaacatggtgcaacatattgtgatatattag |
16486487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 83 - 112
Target Start/End: Original strand, 16486569 - 16486598
Alignment:
| Q |
83 |
atagaattaatctttgcatttgtatgttaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16486569 |
atagaattaatctttgcatttgtatgttaa |
16486598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University