View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3173_low_95 (Length: 254)
Name: NF3173_low_95
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3173_low_95 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 14 - 254
Target Start/End: Complemental strand, 13738333 - 13738093
Alignment:
| Q |
14 |
gagaaggccgattgatgtacttttaatggttaacaaaatatataataaataagtggttggttaatcacattcattttaatgcttaatgaagtactaacga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13738333 |
gagaaggccgattgatgtacttttaatggttaacaaaacatataataaataagtggttggttaatcacattcattttaatgcttaatgaagtactaacga |
13738234 |
T |
|
| Q |
114 |
agtactttannnnnnnnnnnnnnnncggtaagtactctatttagtcaatgacataaaattgcatgctgttgttgttgttttgttttaaaataaaatataa |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13738233 |
agtactttatttgttttttgtttttgggtaagtactctatttagtcaatgacataaaattgcatgctgttgttgttgttttgttttaaaataaaatataa |
13738134 |
T |
|
| Q |
214 |
ttcattaaggtcaattaacaagaattaggggtgctcgtggt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13738133 |
ttcattaaggtcaattaacaagaattaggggtgctcatggt |
13738093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University