View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3173_low_99 (Length: 250)

Name: NF3173_low_99
Description: NF3173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3173_low_99
NF3173_low_99
[»] chr8 (1 HSPs)
chr8 (19-250)||(30667739-30667970)


Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 30667739 - 30667970
Alignment:
19 acgttatgactccagtctttgatggagaaatagacacttcttgatgagtgttttccactgagaaatacttcaaaaggtgggacacatcaaaggaggagaa 118  Q
    |||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
30667739 acgttatgactcaagtctttgacggagaaatagacacttattgatgagtgttttccactgagaaatacttcaaaaggtgggacacatcaaaagaggagaa 30667838  T
119 aattttggtggctgggattgcaatgagagaccgggctctcacatagtgactctggtggtatccatgccatccattagtgagttgtgacgcttttagcact 218  Q
     |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
30667839 gattttggtggctgggattgcaatgagaggccgggctctcacatagtgactctgatggtatccatgccatccattagtgagttgtgacgcttttagcact 30667938  T
219 gtattgatgtggcagatttaaggccgaatatc 250  Q
    |||||||||||||||||||||||| |||||||    
30667939 gtattgatgtggcagatttaaggctgaatatc 30667970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University