View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3174_high_9 (Length: 243)

Name: NF3174_high_9
Description: NF3174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3174_high_9
NF3174_high_9
[»] chr1 (1 HSPs)
chr1 (1-161)||(3139073-3139233)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 3139073 - 3139233
Alignment:
1 aattgttggatatttattaggatgacgcaatgagtaacttttagacaaagtactatagtgatcatccttaaacctatgtttgtaaaaattgctcgtactc 100  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||    
3139073 aattgttggatatttattaggatgacgcaatgagtaacctttagacaaagtactatagtgattatccttagacctatgtttgtaaaaattgctcgtactc 3139172  T
101 gagcccttatcaacgtgagtaactagtttagtgcatgtacccacgttcattatccgcattt 161  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
3139173 gagcccttatcaacgtgagtaactagtttagtgcatgtatccacgttcattatccgcattt 3139233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University