View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3174_low_14 (Length: 243)
Name: NF3174_low_14
Description: NF3174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3174_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 3139073 - 3139233
Alignment:
| Q |
1 |
aattgttggatatttattaggatgacgcaatgagtaacttttagacaaagtactatagtgatcatccttaaacctatgtttgtaaaaattgctcgtactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3139073 |
aattgttggatatttattaggatgacgcaatgagtaacctttagacaaagtactatagtgattatccttagacctatgtttgtaaaaattgctcgtactc |
3139172 |
T |
|
| Q |
101 |
gagcccttatcaacgtgagtaactagtttagtgcatgtacccacgttcattatccgcattt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3139173 |
gagcccttatcaacgtgagtaactagtttagtgcatgtatccacgttcattatccgcattt |
3139233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University