View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3174_low_15 (Length: 238)
Name: NF3174_low_15
Description: NF3174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3174_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28437384 - 28437616
Alignment:
| Q |
1 |
ctgcaaaacatgcagaagatattggacaaatggtggatcgttgcgtaacgttccgattggtggtggttgtagaaagaaacaaaaactcaaacactcatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28437384 |
ctgcaaaacatgcagaagatattggacaaatggtggatcgttgcgtaacgttccgattggtggtggttgtagaaagaaacaaaaactcaaacactcatct |
28437483 |
T |
|
| Q |
101 |
acaccatctcaagccattaataagtactctacttcaccttctcttgattttcatcttggttctttac------------ccttacctttctcttcaaaac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28437484 |
acaccatctcaagccattaataagtactctacttcaccttctcttgattttcatcttggttctttacccttacctttatccttacctttctcttcaaaac |
28437583 |
T |
|
| Q |
189 |
cattttactataaccaattttcttccattggtg |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
28437584 |
cattttactataaccaattctcttccattggtg |
28437616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 13481090 - 13481164
Alignment:
| Q |
1 |
ctgcaaaacatgcagaagatattggacaaatggtggatcgttgcgtaacgttccgattggtggtggttgtagaaa |
75 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| | || || |||||||| || |||||||| |||||||| |
|
|
| T |
13481090 |
ctgcaaaacatgtagaagatattggacaaaaggtggagctttacgcaacgttccaatcggtggtggatgtagaaa |
13481164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University