View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3174_low_19 (Length: 232)
Name: NF3174_low_19
Description: NF3174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3174_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 44956395 - 44956610
Alignment:
| Q |
1 |
ttgagcttttgcaaatggaactaaatgagaatatctttgaatatttcaatagaataacagtggtgggaaaccaggtgaagatgtgtatgatcaaaaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44956395 |
ttgagcttttgcaaatggaactaaatgagaatatctttgaatatttcaatagaataacagtggtgggaaaccaggtgaagatgtgtatgatcaaaaaatg |
44956494 |
T |
 |
| Q |
101 |
gtgaacaaggtaatgcacactctttcttgaaaatttggttacatatatagaagttgcaattgaggaatcaagggacttgtaagttatgaaagttgaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44956495 |
gtgaacaaggtaatgcacactctttcttgaaaatttggttacatatatagaagttgcaattgaggaatcaagggacttgtaagttatgaaagttgaggaa |
44956594 |
T |
 |
| Q |
201 |
tttcagtgtgttcttt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44956595 |
tttcagtgtgttcttt |
44956610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 46
Target Start/End: Original strand, 4309779 - 4309819
Alignment:
| Q |
6 |
cttttgcaaatggaactaaatgagaatatctttgaatattt |
46 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
4309779 |
cttttgcaaatggaaccaaatgaaaatatttttgaatattt |
4309819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University