View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3174_low_5 (Length: 381)
Name: NF3174_low_5
Description: NF3174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3174_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 15 - 324
Target Start/End: Original strand, 26857865 - 26858174
Alignment:
| Q |
15 |
gagaagaagcttgatgatggagttgtgacatggttttgggtaaagaacgagacgaatcaaagagttgtgtatagagaagttgtggttaagagtggtgaag |
114 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
26857865 |
gagaagaagctcgatgatggaattgtgacatggttttgggtaaagaatgagacgaatcaaagagttgtgtatagagaagtcgtggttaaaagtggtgaag |
26857964 |
T |
|
| Q |
115 |
aaacaattgcagcaattgatgatatgaaagatggtggttatgatcttttgataattggaaggaaacaagggattaacccttctcttcttacagggttatc |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26857965 |
aaacaattgcagcaattcatgatatgaaagatgttggttatgatcttttgatagttggaaggaaacaagggattaacccttctcttcttacagggttatc |
26858064 |
T |
|
| Q |
215 |
tgaatggagtgaaagtgatgagttaggaatcattggtgattatgttagttctcaagatttttctacctcagcttctgttttagtggtacaacaacaaatc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26858065 |
tgaatggagtgaaagtgatgagttaggaatcattggtgattatgttagttctcaagatttttctacctcagcttctgttttagtggtacaacaacaaatc |
26858164 |
T |
|
| Q |
315 |
cgaagaggtt |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
26858165 |
cgaagaggtt |
26858174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University