View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_12 (Length: 411)
Name: NF3175_high_12
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 41314440 - 41314154
Alignment:
| Q |
1 |
agacgagcggaaatcaatggcagcgaaatgagcaagaatatcatgaagattaacaaagataataatggtaagagcaataagaagaacaacgaggcccgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314440 |
agacgagcggaaatcaatggcagcaaaatgagcaagaatatcatgaagattaacaaagataataatggtaagagcaataagaagaacaacgaggcccgaa |
41314341 |
T |
|
| Q |
101 |
cgggcttcaggagaaagctgggccacaaaaccggaacaaaggatcacggtggcaaatagatataggcctgcgtttatgtattcgtaacggtttctagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314340 |
cgggcttcaggagaaagctgggccacaaaaccggaacaaaggatcacggtggcaaatagatataggcctgcgtttatgtattcgtaacggtttctagtga |
41314241 |
T |
|
| Q |
201 |
ggcccgggccgtatgtacggaactctcttgctgaagctagtttcaccattgtctgaaaaggaatgtgtgtgttagtgttgggttggtt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41314240 |
ggcccgggccgtatgtacggaactctcttgctgaagctagtttcaccattgtctgaaaaggaatgtgtgtg-tagtgttgggttggtt |
41314154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 382
Target Start/End: Complemental strand, 41314102 - 41314060
Alignment:
| Q |
340 |
ttttggattggacacgtggctacttgcatgcagttgtgttggt |
382 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41314102 |
ttttggcttggacacgtggctacttgcatggagttgtgttggt |
41314060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University