View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_17 (Length: 332)
Name: NF3175_high_17
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 170 - 325
Target Start/End: Complemental strand, 490306 - 490151
Alignment:
| Q |
170 |
tcataagtttgaaagtttcaataatcttcatcctatgctcagaatatatactgaacaaaggaccattttgaagaagtaggccatggtatttgaatcacaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
490306 |
tcataagtttgaaagtttcaataatcttcatcctatgctcagaatatatactgaacaaaggaccattttgaagaactaggccatggtacttgaatcacaa |
490207 |
T |
 |
| Q |
270 |
ccatgaactctttatattcaaaatcaacttctttgccatcaattccacaagccctt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
490206 |
ccatgaactctttatattcaaaatcaacttctttgccatcaattccacaagccctt |
490151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 490458 - 490406
Alignment:
| Q |
18 |
attagaaactagatgttctgaatgacaaaagttacttccttcaccacagaagg |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
490458 |
attagaaactagatgttctgaatgacaaaagttacttccttcaccacagaagg |
490406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University