View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3175_high_25 (Length: 281)

Name: NF3175_high_25
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3175_high_25
NF3175_high_25
[»] chr3 (1 HSPs)
chr3 (87-266)||(54123600-54123782)
[»] chr7 (1 HSPs)
chr7 (135-194)||(19851380-19851439)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 87 - 266
Target Start/End: Original strand, 54123600 - 54123782
Alignment:
87 gtttgcttagaaactacgatttaggttttcgtgctg---attagggattttaactcaatctagtgtaatgctgactgttcttggcatggattgcaggtat 183  Q
    |||||||||||||||| ||||||||||||| || ||   ||||||||||||||||| ||||||||||||||| | || |||||| ||||||| |||||||    
54123600 gtttgcttagaaactatgatttaggttttcttgttgttgattagggattttaactcgatctagtgtaatgcttattgatcttggtatggattacaggtat 54123699  T
184 ggatgcatgctggtcaggccaaaactggtttccttgggaggaatgatttttataatgctttgaaattagtaactcttgcacag 266  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
54123700 ggatgcatgctgatcaggccaaaactggtttccttgggaggaatgatttttataatgctttgaaattagtaactgttgcacag 54123782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 135 - 194
Target Start/End: Complemental strand, 19851439 - 19851380
Alignment:
135 aactcaatctagtgtaatgctgactgttcttggcatggattgcaggtatggatgcatgct 194  Q
    ||||| ||||||||||||||| | ||||||||||||||||| ||||||||||||||||||    
19851439 aactcgatctagtgtaatgcttattgttcttggcatggattacaggtatggatgcatgct 19851380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University