View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_25 (Length: 281)
Name: NF3175_high_25
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 87 - 266
Target Start/End: Original strand, 54123600 - 54123782
Alignment:
| Q |
87 |
gtttgcttagaaactacgatttaggttttcgtgctg---attagggattttaactcaatctagtgtaatgctgactgttcttggcatggattgcaggtat |
183 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || || ||||||||||||||||| ||||||||||||||| | || |||||| ||||||| ||||||| |
|
|
| T |
54123600 |
gtttgcttagaaactatgatttaggttttcttgttgttgattagggattttaactcgatctagtgtaatgcttattgatcttggtatggattacaggtat |
54123699 |
T |
 |
| Q |
184 |
ggatgcatgctggtcaggccaaaactggtttccttgggaggaatgatttttataatgctttgaaattagtaactcttgcacag |
266 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54123700 |
ggatgcatgctgatcaggccaaaactggtttccttgggaggaatgatttttataatgctttgaaattagtaactgttgcacag |
54123782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 135 - 194
Target Start/End: Complemental strand, 19851439 - 19851380
Alignment:
| Q |
135 |
aactcaatctagtgtaatgctgactgttcttggcatggattgcaggtatggatgcatgct |
194 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19851439 |
aactcgatctagtgtaatgcttattgttcttggcatggattacaggtatggatgcatgct |
19851380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University