View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3175_high_29 (Length: 267)

Name: NF3175_high_29
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3175_high_29
NF3175_high_29
[»] chr1 (2 HSPs)
chr1 (106-192)||(26000254-26000340)
chr1 (217-260)||(26000337-26000380)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 26000254 - 26000340
Alignment:
106 aacgaattgttgaaataaacgtctcccccgaatcttcaagatccctctcttgcaatcttaaagcaataaactccctcgtagaaacac 192  Q
    |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||  |||||||||    
26000254 aacgaactgttgaaataaacgtctcccccgaatcttcaagatctctctcttgcaatcttaaagcaacaaactccctaatagaaacac 26000340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 260
Target Start/End: Original strand, 26000337 - 26000380
Alignment:
217 acactgtcaattcattaagttcaatgtgttcttgatgatgatgt 260  Q
    |||||||||||||||||||||||||||||||||||| |||||||    
26000337 acactgtcaattcattaagttcaatgtgttcttgataatgatgt 26000380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University