View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3175_high_32 (Length: 250)

Name: NF3175_high_32
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3175_high_32
NF3175_high_32
[»] chr4 (1 HSPs)
chr4 (16-250)||(26847119-26847351)


Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 26847351 - 26847119
Alignment:
16 attgcatagaaattctagataaaaattgtaaatggataagaaaacaaatgatgggagannnnnnnaacagatttttacagaagtttattaacgagtgcct 115  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
26847351 attgcatagaaattctagataaaaattgtaaacggataagaaaacaaatgatgggagatttttttaacagatttttacagaagtttattaacgagtgcct 26847252  T
116 ctacattgtttgatgaatgaaggactagttgaaggaactttgtatccttcaacagcttttgtatgttgcattttcataaccccatctaaagaatcaatct 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |    
26847251 ctacattgtttgatgaatgaaggactagttgaaggaactttgtatccttcaacagcttttgtatgttgcattttcataaccccatctaaagaatcaa--t 26847154  T
216 ggggaacattcgaattagcactaagctgagggaat 250  Q
     ||||||||||||||||||||||||||||||||||    
26847153 tgggaacattcgaattagcactaagctgagggaat 26847119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University