View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_35 (Length: 248)
Name: NF3175_high_35
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 8556141 - 8555903
Alignment:
| Q |
1 |
aatggtcgtataaatgcaacatagatgcagcttttactaatcatttgaatcgga--gggataggcatttgtgtgacagatgagaacatttcttttggcgc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8556141 |
aatggtcgtataaatgcaacatagatgcagcttttactgatcatttaaatcggacagggataggaatttgtgtgacggatgagaaaatttcttttggcgc |
8556042 |
T |
 |
| Q |
99 |
agactttgttatttgatcttgtttacacaattgaagtaggagaagcattgggtttgtatcatgcgctacaatggccgagtgataacagtttgaccaaatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8556041 |
agactttgttatttgatcttgtttacacaattgaagcaggagaagcattgggtttgtatcatgcgctacaatggccgagtgataacagtttgaccatatt |
8555942 |
T |
 |
| Q |
199 |
gatttcaacgtaaactccaaaattacaaacgacacatat |
237 |
Q |
| |
|
|||||| | ||| |||||||||||||||||||| ||||| |
|
|
| T |
8555941 |
gatttctaggtagactccaaaattacaaacgacgcatat |
8555903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University