View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_36 (Length: 247)
Name: NF3175_high_36
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 247
Target Start/End: Original strand, 48402619 - 48402846
Alignment:
| Q |
20 |
ccttctgggacttatgggaacaagcatgaatgtccttgctacagagacaaggttaacaataagggaaagcccaaatgcccttgatgtcaattactaacaa |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48402619 |
ccttctgggacttatggaaacaagcatgaatgtccttgctacagagacaaggttaacaataagggaaagcccaaatgcccttgatgtcaattactaacaa |
48402718 |
T |
 |
| Q |
120 |
agaccaaagcgagtgcccttatgtgtttactgtttgttttaggagttcaccaagatggttagtgagtgctacctgtgtaaggtgttagcgatttctcagt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48402719 |
agaccaaagcgagtgcccttatgtgtttactgtttgttttaggagttcaccaagatggttagtgagtgctacctgtgtaaggtgttagcgatttctcagt |
48402818 |
T |
 |
| Q |
220 |
atgttcgattcatcttgttacttcagtt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
48402819 |
atgttcgattcatcttgttacttcagtt |
48402846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University