View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_41 (Length: 239)
Name: NF3175_high_41
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 18032887 - 18032667
Alignment:
| Q |
1 |
ataacagaaccaaagattaggttgtttgtaactaaacaaaccgacggcgtcgacgcacgaatagattgacgacgatgtcttgtaaaaaccccagtggggt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||| |
|
|
| T |
18032887 |
ataacagaaccagagattaggttgtttgtaactaaacaaaccgacggcgtcgacgcacgaatagattgacgacgatgtcttgtaaaaatcctagtcgggt |
18032788 |
T |
 |
| Q |
101 |
acaaggcgatgctgcaatgtagatgagactccaaacctgtgcatcgcttccggatatcttcatctcgcagggtgatgggtttgattatggaggggtaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
18032787 |
acaaggcgatgctgcaatgtagatgaaactccaaacttgtgcatcgcttccggatatcttcatctcgcaggatgatgggtttgattatggagggttaggt |
18032688 |
T |
 |
| Q |
201 |
ggtgaggggtgaagccccatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
18032687 |
ggtgaggggtgaagccccatt |
18032667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University