View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_42 (Length: 239)
Name: NF3175_high_42
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 118
Target Start/End: Complemental strand, 8556389 - 8556296
Alignment:
| Q |
25 |
aatgtttaagttgtttgtaggatgagaaagaagccaagagaagttggttgcaggccggtacaaggcgagcctgcagcaagggtgtagattgcac |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556389 |
aatgtctaagttgtttgtaggatgagaaagaagccaagagaagttggttgcaggccggtacaaggcgagcctgcagcaagggtgtagattgcac |
8556296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 152 - 239
Target Start/End: Complemental strand, 8556262 - 8556174
Alignment:
| Q |
152 |
gtttcaattaaacgatgttgaaaataatttcaagttt-aattttttagttgcttgagacttgcagtttccgaaatctaaaagctaattt |
239 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556262 |
gtttcaattgaacgatgttgaaaataatttcaagttttaattttttagttgcttgagacttgcagtttccgaaatctaaaagctaattt |
8556174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University