View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_47 (Length: 236)
Name: NF3175_high_47
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 37217466 - 37217422
Alignment:
| Q |
24 |
ttgcattaattttatttgatttttagaagaagagtaagttttaca |
68 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
37217466 |
ttgcattaattttatttgatttctaaaagaagagtaagttttaca |
37217422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University