View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3175_high_47 (Length: 236)

Name: NF3175_high_47
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3175_high_47
NF3175_high_47
[»] chr7 (1 HSPs)
chr7 (24-68)||(37217422-37217466)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 37217466 - 37217422
Alignment:
24 ttgcattaattttatttgatttttagaagaagagtaagttttaca 68  Q
    |||||||||||||||||||||| || |||||||||||||||||||    
37217466 ttgcattaattttatttgatttctaaaagaagagtaagttttaca 37217422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University