View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_high_55 (Length: 201)
Name: NF3175_high_55
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 187
Target Start/End: Original strand, 11618291 - 11618465
Alignment:
| Q |
13 |
agcagagataattagtggcaatattttgaagatgtcaaaatctttcaatgatagaaaggataaagaaggaataaatcatgcagtgatgtcactaaggaat |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11618291 |
agcagaaataattagtggcaatattttgaagatgtcaaaatctttcaatgatagaaaggataaagaaggaataaatcatgcagtgatgtcactaaggaat |
11618390 |
T |
 |
| Q |
113 |
gaagctagaagttggtttagtgagatgataagaaaatcaaattctcaaggtggtggtggtgatgatgattcttat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11618391 |
gaagctagaagttggtttagtgagatgataagaaaatcaaattctcaaggtggtggtggtgatgatgattcttat |
11618465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University