View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_24 (Length: 314)
Name: NF3175_low_24
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 2 - 300
Target Start/End: Original strand, 10033101 - 10033399
Alignment:
| Q |
2 |
ttggaatttattcttagagggatagacaatgaataattgggctcctcctctcatagctgcagctctattttggctattatcaccaggaatgatttttcag |
101 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10033101 |
ttggaattgattcttagaggtatagagaatgaataattgggctcctcctctcatagctgcagctttattttggctattatcaccaggaatgatttttcag |
10033200 |
T |
 |
| Q |
102 |
cttccagggaagaattcaccattggagtttatgaatatgaagacaactattgcatcaatttttgtacacactgttctttatggtttgcttctcatgttgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10033201 |
cttccagggaagaattcaccattggagtttatgaatatgaagacaactattgcatcaatttttgtacacactgttctttatggtttgcttctcatgttgt |
10033300 |
T |
 |
| Q |
202 |
tctttgttgttcttgatcttcatctttatatcacttgaagtagatcaagtgataataataatatatgttacttttgatttttcctttcatacttgtttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10033301 |
tctttgttgttcttgatcttcatctttatatcacttgaagtagatcaagtgataataataatatatgttacttttgatttttcctttcatacttgtttt |
10033399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University