View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_35 (Length: 267)
Name: NF3175_low_35
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 106 - 192
Target Start/End: Original strand, 26000254 - 26000340
Alignment:
| Q |
106 |
aacgaattgttgaaataaacgtctcccccgaatcttcaagatccctctcttgcaatcttaaagcaataaactccctcgtagaaacac |
192 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
26000254 |
aacgaactgttgaaataaacgtctcccccgaatcttcaagatctctctcttgcaatcttaaagcaacaaactccctaatagaaacac |
26000340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 260
Target Start/End: Original strand, 26000337 - 26000380
Alignment:
| Q |
217 |
acactgtcaattcattaagttcaatgtgttcttgatgatgatgt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26000337 |
acactgtcaattcattaagttcaatgtgttcttgataatgatgt |
26000380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University