View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_38 (Length: 250)
Name: NF3175_low_38
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_38 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 26847351 - 26847119
Alignment:
| Q |
16 |
attgcatagaaattctagataaaaattgtaaatggataagaaaacaaatgatgggagannnnnnnaacagatttttacagaagtttattaacgagtgcct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26847351 |
attgcatagaaattctagataaaaattgtaaacggataagaaaacaaatgatgggagatttttttaacagatttttacagaagtttattaacgagtgcct |
26847252 |
T |
|
| Q |
116 |
ctacattgtttgatgaatgaaggactagttgaaggaactttgtatccttcaacagcttttgtatgttgcattttcataaccccatctaaagaatcaatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26847251 |
ctacattgtttgatgaatgaaggactagttgaaggaactttgtatccttcaacagcttttgtatgttgcattttcataaccccatctaaagaatcaa--t |
26847154 |
T |
|
| Q |
216 |
ggggaacattcgaattagcactaagctgagggaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26847153 |
tgggaacattcgaattagcactaagctgagggaat |
26847119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University