View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_39 (Length: 250)
Name: NF3175_low_39
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 7724090 - 7723854
Alignment:
| Q |
1 |
catcgcaatcaaaaacatcttctacatatcattatcattggtcttgaccgtcctagctgctttactaaatctattactattttaacattattattaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7724090 |
catcgcaatcaaaaacatcttctacatatcattatcattggtcttgaccgtcctagctgctttactaaatctattactattataacattattattaatat |
7723991 |
T |
|
| Q |
101 |
ttttcatgaacgaggcttgttctatcagagtctccaagagagaaatggaatgccattttcagaatcatgattggtttcatcaatgaaacggaactcgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723990 |
ttttcatgaacgaggcttgttctatcagagtctccaagagagaaatggaatgccattttcagaatcatgattggtttcatcaatgaaacggaactcgtta |
7723891 |
T |
|
| Q |
201 |
gtcattgctggagagaaacactgcatcttctggttct |
237 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
7723890 |
gtaattgccggagagaaacactgcatcttctggttct |
7723854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University