View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_43 (Length: 244)
Name: NF3175_low_43
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 9406862 - 9407035
Alignment:
| Q |
1 |
ttgtttacacgaagagttagtctctactattaatgatttcaacatannnnnnnaacaagcaaaatgaaatatattaacatnnnnnnnggaaactcattag |
100 |
Q |
| |
|
|||| ||| |||||| ||| ||||||| |||||| |||||||| || |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
9406862 |
ttgtctactcgaagaattaatctctacaattaataatttcaacgtatttttttaacaagcaaaatgaaatatattaaaaaaaa-----gaaactcattag |
9406956 |
T |
 |
| Q |
101 |
cataagatgtattagagagaaacattaatgattttaaagttacactccgataatttaatatgtactatgcaatcgattg |
179 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
9406957 |
cataagatgtgttagagaaaaacactaatgattttaaagttacactccgataatttaatatgtaccatgcaatcaattg |
9407035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University